Review

cd111 nectin (Sino Biological)

Sino Biological is a verified supplier

Sino Biological manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Sino Biological cd111 nectin
Cd111 Nectin, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/us12590150-164-2-7?v=Sino+Biological
Average 94 stars, based on 1 article reviews

cd111 nectin - by Bioz Stars, 2026-07

94/100 stars

Images

Similar Products

cd111 nectin (Sino Biological)

cd111 nectin - by Bioz Stars, 2026-07

94/100 stars

Buy from Supplier

recombinant human nectin 1 (Miltenyi Biotec)

Miltenyi Biotec recombinant human nectin 1
Recombinant Human Nectin 1, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/pmc12412668-400-13-29?v=Miltenyi+Biotec
Average 94 stars, based on 1 article reviews

recombinant human nectin 1 - by Bioz Stars, 2026-07

94/100 stars

Buy from Supplier

80244 rp01 100 (Sino Biological)

Sino Biological 80244 rp01 100
80244 Rp01 100, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/us12590150-164-6-7?v=Sino+Biological
Average 94 stars, based on 1 article reviews

80244 rp01 100 - by Bioz Stars, 2026-07

94/100 stars

Buy from Supplier

cd111 sc 21722 (Santa Cruz Biotechnology)

Santa Cruz Biotechnology cd111 sc 21722
Cd111 Sc 21722, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/pm41382272-1078-107-109?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews

cd111 sc 21722 - by Bioz Stars, 2026-07

93/100 stars

Buy from Supplier

human nectin 1 (Sino Biological)

Sino Biological human nectin 1
Human Nectin 1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/us12364768-1351-12-21?v=Sino+Biological
Average 93 stars, based on 1 article reviews

human nectin 1 - by Bioz Stars, 2026-07

93/100 stars

Buy from Supplier

his cd111 (R&D Systems)

R&D Systems his cd111
His Cd111, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/bio_rxiv__2025__05__08__652881-313-17-19?v=R%26D+Systems
Average 93 stars, based on 1 article reviews

his cd111 - by Bioz Stars, 2026-07

93/100 stars

Buy from Supplier

expression plasmid sino biological hg11611 ut software (Sino Biological)

Sino Biological expression plasmid sino biological hg11611 ut software
Expression Plasmid Sino Biological Hg11611 Ut Software, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/pmc11148645__mmc2-188-192-194?v=Sino+Biological
Average 92 stars, based on 1 article reviews

expression plasmid sino biological hg11611 ut software - by Bioz Stars, 2026-07

92/100 stars

Buy from Supplier

tacccatacgatgttccagat tacgtct 30 n a human cd111 nectin (Sino Biological)

Sino Biological tacccatacgatgttccagat tacgtct 30 n a human cd111 nectin
Tacccatacgatgttccagat Tacgtct 30 N A Human Cd111 Nectin, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/pmc11148645__mmc2-188-182-194?v=Sino+Biological
Average 92 stars, based on 1 article reviews

tacccatacgatgttccagat tacgtct 30 n a human cd111 nectin - by Bioz Stars, 2026-07

92/100 stars

Buy from Supplier

human cd111 nectin 1 pvrl1 gene orf cdna clone expression plasmid (Sino Biological)

Sino Biological human cd111 nectin 1 pvrl1 gene orf cdna clone expression plasmid

Human Cd111 Nectin 1 Pvrl1 Gene Orf Cdna Clone Expression Plasmid, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cd111+nectin/pmc11148645-135-0-9?v=Sino+Biological
Average 92 stars, based on 1 article reviews

human cd111 nectin 1 pvrl1 gene orf cdna clone expression plasmid - by Bioz Stars, 2026-07

92/100 stars

Buy from Supplier

Image Search Results

Journal: Cell Reports Medicine

Article Title: Exogenous non-coding dsDNA-dependent trans -activation of phagocytes augments anti-tumor immunity

doi: 10.1016/j.xcrm.2024.101528

Figure Lengend Snippet:

Article Snippet: Human CD111/Nectin-1/PVRL1 Gene ORF cDNA clone expression plasmid , Sino Biological , HG11611-UT.

Techniques: Staining, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot, Knock-Out, Plasmid Preparation, Expressing, Software, Microscopy